tsakiridis ban july21

sidiropoulos oil

Παντελής Μαϊόβης, Νευρολόγος, MSc, PhD
The Espressonist

Δείτε το φυλλάδιο προσφορών!

Ιδιωτικά Εκπαιδευτήρια: Προτεινόμενες απαντήσεις βιολογίας θετικής κατεύθυνσης

ΘΕΜΑ Α

Α1. δ

Α2. γ

Α3. β

Α4. γ

Α5. β

ΘΕΜΑ Β

Β1. Η σωστή σειρά των βημάτων είναι η εξής: 4, 2, 1, 6, 3, 5

Β2. α. Η επιμήκυνση του πρωταρχικού τμήματος κατά την αντιγραφή καταλύεται από τις DNA πολυμεράσες.

β. Η σύνθεση των πρωταρχικών τμημάτων καταλύεται από το σύμπλοκο ενζύμων που ονομάζεται πριμόσωμα.

γ. Η σύνδεση των κομματιών της ασυνεχούς αλυσίδας μεταξύ τους κατά την αντιγραφή καταλύεται από το ένζυμο DNA δεσμάση.

δ. Το ξετύλιγμα της διπλής έλικας του DNA κατά την αντιγραφή καταλύεται από τις DNA ελικάσες.

ε. Η σύνδεση ριβονουκλεοτιδίων κατά τη μεταγραφή καταλύεται από το ένζυμο RNA πολυμεράση.

Β3. Σελ. 98 Σχολ. Βιβλίου: Από «Η διάγνωση των γενετικών ασθενειών μπορεί να πραγματοποιηθεί:………» εως «……..της αλληλουχίας των βάσεων του DNA (μοριακή διάγνωση).»

Β4. Σελ 133 Σχολ. Βιβλίου: Διαγονιδιακά ονομάζονται τα ζώα εκείνα στα οποία έχει τροποποιηθεί το γενετικό υλικό τους με την προσθήκη γονιδίων, συνήθως από κάποιο άλλο είδος.

Β5. Σελ. 109 Σχολ. Βιβλίου: Από «Με τον όρο ζύμωση εννοούμε τη διαδικασία ανάπτυξης μικροοργανισμών……» εως «…..προϊόντα των κυττάρων όπως πρωτεϊνες και αντιβιοτικά.»

Γ1. Η ασθένεια αποκλείεται να οφείλεται σε επικρατές γονίδιο, λόγω του γεγονότος ότι το άτομο ΙΙ3 πάσχει, ενώ οι γονείς του (άτομα Ι1 και Ι2) είναι υγιή. Στην επικρατή κληρονομικότητα, κάθε ασθενής στο γενεαλογικό δέντρο έχει τουλάχιστον έναν ασθενή γονέα. Επομένως, οφείλεται σε υπολειπόμενο γονίδιο.

Γ2. Η ασθένεια οφείλεται σε αυτοσωμικό γονίδιο. Αποκλείουμε τη φυλοσύνδετη (υπολειπόμενη) κληρονομικότητα εξαιτίας του ατόμου ΙΙΙ1, δηλαδή του απογόνου που αποκτούν τα άτομα ΙΙ4 και ΙΙ5. Πρόκειται για άτομο που εμφανίζει την ασθένεια. Αν η ασθένεια οφειλόταν σε φυλοσύνδετο γονίδιο, τότε και τα δύο φυλετικά Χ χρωμοσώματα του ατόμου αυτού θα έπρεπε να φέρουν το υπολειπόμενο γονίδιο. Θα έπρεπε δηλαδή και οι δύο γονείς του να του κληροδοτήσουν από ένα Χ χρωμόσωμα που φέρει υπολειπόμενο γονίδιο ασθένειας. Ο πατέρας του ατόμου ΙΙΙ1 όμως (άτομο ΙΙ4), είναι υγιής, πράγμα που σημαίνει πως το μοναδικό Χ χρωμόσωμά του φέρει το επικρατές φυσιολογικό γονίδιο.

Γ3.  Θέτοντας ως Α το επικρατές φυσιολογικό γονίδιο και ως α το υπολειπόμενο γονίδιο της ασθένειας, έχουμε τα ακόλουθα.

ΙΙ1: ΑΑ ή Αα

ΙΙ2: ΑΑ ή Αα

ΙΙ3: αα (λόγω του γεγονότος ότι πάσχει)

ΙΙ4: Αα (λόγω του γεγονότος ότι αποκτάει απόγονο με γονότυπο αα)

Γ4. Με βάση τα δεδομένα του πίνακα, οριστικοποιούνται οι γονότυποι των ατόμων ΙΙ1 και ΙΙ2. Επειδή ο ανιχνευτής δεν υβριδοποιεί κανένα μόριο DNA στο άτομο ΙΙ1, σημαίνει πως το άτομο αυτό δεν έχει κανένα παθολογικό γονίδιο, έχει δηλαδή γονότυπο ΑΑ (ομόζυγο για το φυσιολογικό γονίδιο). Επειδή ο ανιχνευτής υβριδοποιεί μόνο ένα μόριο DNA στο άτομο ΙΙ2, σημαίνει πως ένα μόνο από τα δύο αλληλόμορφα γονίδια του ατόμου αυτού είναι παθολογικό. Άρα το άτομο ΙΙ2 έχει γονότυπο Αα (ετερόζυγο).

Γ5. Η αχρωματοψία στο πράσινο και κόκκινο χρώμα είναι ασθένεια με υπολειπόμενη φυλοσύνδετη κληρονομικότητα. Αυτό σημαίνει πως το γονίδιο στο οποίο οφείλεται η ασθένεια είναι υπολειπόμενο σε σχέση με το φυσιολογικό, ενώ η γενετική του θέση εντοπίζεται στο Χ φυλετικό χρωμόσωμα. Ο πατέρας του συγκεκριμένου αγοριού διαθέτει το φυσιολογικό αλληλόμορφο στο μοναδικό του Χ χρωμόσωμα, εφόσον είναι υγιής. Η μητέρα του αγοριού είναι σίγουρα φορέας του παθολογικού γονιδίου, διότι, από τη μία δεν πάσχει, από την άλλη όμως πρέπει κάποιος από τους δύο γονείς να διαθέτει το παθολογικό γονίδιο για να το κληροδοτήσει στο παιδί.

Το αγόρι με σύνδρομο Klinefelter διαθέτει τρισωμία φυλετικών χρωμοσωμάτων ΧΧΥ. Για να πάσχει από αχρωματοψία, θα πρέπει και τα δύο Χ χρωμοσώματά του να διαθέτουν το παθολογικό γονίδιο. Αυτό σημαίνει πως τα δύο Χ χρωμοσώματα τα κληρονόμησε από τη μητέρα του. Φυσικά, το Υ χρωμόσωμα το κληρονόμησε από τον πατέρα του.

Για να γεννηθεί το συγκεκριμένο αγόρι, θα πρέπει ένα ωάριο με δύο όμοια Χ χρωμοσώματα (που φέρουν το παθολογικό γονίδιο) να γονιμοποιηθεί από ένα σπερματοζωάριο με Υ χρωμόσωμα. Ο μόνος τρόπος για να προκύψει ωάριο με δύο όμοια Χ χρωμοσώματα, είναι να γίνει μη διαχωρισμός των αδελφών χρωματίδων, κατά τη δεύτερη μειωτική διαίρεση της μητέρας. Φυσικά, μιλάμε για τις αδελφές χρωματίδες που δημιουργήθηκαν από την αντιγραφή εκείνου του ινιδίου χρωματίνης που φέρει το γονίδιο της ασθένειας.

ΘΕΜΑ Δ

Δ1.

5΄AGCT-­ ATGACCATGATTACGGATTCACTG 3΄αλυσίδα Ι

3΄TCGA-­  TACTGGTACTAATGCCTAAGTGAC 5΄αλυσίδα II

Το κωδικόνιο έναρξης ATG βρίσκεται στο 5΄ άκρο της κωδικής αλυσίδας και με

βήμα τριπλέτας από αυτό έχουμε τα 8 κωδικόνια που αντιστοιχούν στα 8 πρώτα

αμινοξέα. Επομένως η αλυσίδα I είναι η κωδική και η αλυσίδα ΙΙ είναι η

μεταγραφόμενη με προσανατολισμούς όπως δείχνουμε.

Δ2.

mRNA

5΄AGCUAUGACCAUGAUUACGGAUUCACUG 3΄

Σχολικό σελ.32-­33 από «Κατά την έναρξη της μεταγραφής …… το κινητό

αντίγραφο της πληροφορίας ενός γονιδίου.»

Δ3.

5΄AGCU

Σχολικό σελ.36 από «Κατά την έναρξη της μετάφρασης …….. της συμπληρωματικότητας των βάσεων.»

Δ4.

Για να προκύψουν 1022 αμινοξέα σημαίνει ότι η αντικατάσταση βάσης έγινε

στο 1023ο κωδικόνιο και το μετέτρεψε σε κωδικόνιο λήξης.

Σχολικό σελ.91 από «Σε άλλες περιπτώσεις μια …….. της πρωτεΐνης.»

Δ5.

Σχολικό σελ.40 από «Στο οπερόνιο της λακτόζης περιλαμβάνονται εκτός από τα

δομικά γονίδια και αλληλουχίες DNA που ρυθμίζουν την ……… προσδένονται

συνεχώς στο χειριστή.»

Όταν έχουμε προσθήκη 4 βάσεων (δηλ. αριθμού όχι πολλαπλάσιου του 3) τότε

η αλληλουχία των αμινοξέων δεν εμφανίζει πλέον πολλές ομοιότητες με την

αρχική. (σχολ. Σελ. 91)

Επομένως δεν παράγεται σωστή πρωτεΐνη-καταστολέας και ο χειριστής

παραμένει ελεύθερος και η RNA πολυμεράση δεν εμποδίζεται και αρχίζει την

μεταγραφή των γονιδίων του οπερονίου έστω και απουσίας λακτόζης και

γλυκόζης.

H iRepair έφτασε στην Βέροια!

Ψητοπωλείο

sidiropoulos

studio 69